sábado, 29 de setembro de 2012

Aprendendo Bionformática com Rosalind


Rosalind

Rosalind é um site que propõe a aprendizagem de bioinformática através da solução de problemas computacionais com diversos graus de dificuldade extraídos de problemas reais. Rosalind é uma plataforma de aprendizagem de bioinformática através de solução de problemas.

Rosalind é um projeto inspirado por outros projetos como Project Euler e  Google Code Jam .

Cada problema introduz novos termos da área de bioinformática. O glossário de todos os problemas é bastante extenso:
http://rosalind.info/glossary/

Problem 1

string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string s of length at most 1000 nucleotides.
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in s.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21


Você pode resolver este desafio utilizando qualquer linguagem que você queira uma vez que você precisa apenas enviar a resposta. Você pode aproveitar para a aprender uma nova linguagem de programação e/ou utilizar uma linguagem mais adequada para resolver estes problemas. Eu sugiro a linguagem Python.


s = raw_input()
print "%d %d %d %d" % ( s.count('A') , s.count('C'), s.count('G'), s.count('T')






4 comentários:

Anônimo disse...

Vixe.

Rogério Carvalho disse...

hehehe, fiz esse aew em c. wladimir tu fez esse http://rosalind.info/problems/prot/ ??
já fiz mas ta dando resposta errada, e no exemplo dah certo, tem alguma dica??

Leandro Lima disse...

Rogério, também penei um pouco pra resolver esse aí. Talvez o seu erro esteja sendo o meu. Quando vc encontra uma trinca que gera um stop-codon, esse codon não deve ser impresso e o resultado termina no anterior.

Será que é isso?

Abs!

Rogério Carvalho disse...

kra eu resolvi. eu fiz em c++ usando map(dica do wladimir), só q também não tava dando certo e o mapeamento tava completamente correto assim como o outro código q fiz em c. O problema e que eu tava copiando e colando a resposta no site, quando eu joguei a resposta dentro de um arquivo e enviei funcionou na hora.Não sei o motivo desse erro.